Below is the syntax highlighted version of GeneFind.java
from §3.1 Using Data Types.
/****************************************************************************** * Compilation: javac GeneFind.java * Execution: java GeneFind start stop < input.txt * * To find a gene in a genome, we scan for the start codon, * remember its index, then scan from the next stop codon. * If the length of the intervening sequence is a multiple of 3, * we have found a gene. * * % more genomeTiny.txt * ATAGATGCATAGCGCATAGCTAGATGTGCTAGCAT * * % java GeneFind ATG TAG < genomeTiny.txt * CATAGCGCA * TGC * * % java GeneFind ATG TAG < genomeVirus.txt * CGCCTGCGTCTGTAC * TCGAGCGGATCGCTCACAACCAGTCGG * AGATTATCAAAAAGGATCTTCACC * ******************************************************************************/ public class GeneFind { public static void main(String[] args) { // read in data String start = args[0]; String stop = args[1]; String genome = StdIn.readAll(); StdOut.println("genome = '" + genome + "'"); StdOut.println("start = '" + start + "'"); StdOut.println("stop = '" + stop + "'"); // find genes int beg = -1; for (int i = 0; i < genome.length() - 2; i++) { String codon = genome.substring(i, i+3); // start codon if (codon.equals(start)) beg = i; // stop codon if ((codon.equals(stop)) && (beg != -1) && (beg + 3 < i)) { // check putative gene alignment String gene = genome.substring(beg+3, i); if (gene.length() % 3 == 0) { StdOut.println(gene); beg = -1; } } } } }