Below is the syntax highlighted version of sketchn.py
from §A5 Appendix: NumPy.
#----------------------------------------------------------------------- # sketchn.py #----------------------------------------------------------------------- import sys import stdio import stdarray import numpy #----------------------------------------------------------------------- class Sketch: # Construct a new Sketch object which is a profile of string # text. The profile should consist of a unit vector of dimension # d. Element i of the vector should indicate how many k-grams # in the file (or web page) hash to i. def __init__(self, text, k, d): freq = stdarray.create1D(d, 0) for i in range(len(text) - k): kgram = text[i:i+k] h = hash(kgram) freq[h % d] += 1 a = numpy.array(freq, float) self._sketch = a / numpy.linalg.norm(a) # Unit vector # Return the similarity measure between self and Sketch object # other as a number between 0 and 1. 0 indicates that the # objects are dissimilar; 1 indicates that they are similar. def similarTo(self, other): return self._sketch.dot(other._sketch) # Return a string representation of self. def __str__(self): return str(self._sketch) #----------------------------------------------------------------------- # For testing. # Accept integers k and d as command-line arguments. Read text from # standard input, and construct a Sketch object from that text, k, and # d. Write the Sketch object to standard output. def main(): text = stdio.readAll() k = int(sys.argv[1]) d = int(sys.argv[2]) sketch = Sketch(text, k, d) stdio.writeln(sketch) if __name__ == '__main__': main() #----------------------------------------------------------------------- # more genome20.txt # ATAGATGCATAGCGCATAGC # python sketch.py 2 16 < genome20.txt # [0.37210420376762543, 0.37210420376762543, 0.49613893835683387, # 0.0, 0.12403473458920847, 0.0, # 0.0, 0.0, 0.0, # 0.0, 0.24806946917841693, 0.0, # 0.12403473458920847, 0.6201736729460423, 0.0, 0.0]